segunda-feira, 10 de dezembro de 2018

A Verdadeira História do Natal

É claro, respeito a todos que se negam a celebrar o dia em que Deus, literalmente, demonstrou nos amar trazendo ao mundo o seu Unigênito; logicamente, se se negar-se a comemorar o nascimento do Filho Único do Pai celeste é uma negação com a intenção de agradá-lo, a única reação sensata da minha parte é me esforçar para entender quem viva assim. Mas, o fato de buscar entender não é o mesmo que crer que este estilo de vida esteja baseado na doutrina de Cristo. 

Aos que não celebram o nascimento do Senhor, digo o seguinte. Veja bem, ninguém nega que o Natal de Cristo é uma data célebre! Todos os cristãos sabem que é um dos dias memoráveis entre os poucos dias realmente memoráveis que a história humana tem. Sim, é dia célebre. Os anjos foram os primeiros a celebrar este dia, eles inauguraram a tradição da celebração natalina do Filho de Deus. O nascimento de Jesus é tão célebre que o Adversário das nossas almas tentou acabar com o motivo da nossa celebração naquele episódio em que Herodes decretou a mortandade de meninos de dois anos para baixo. 

Pare e pense nesta projeção: Jesus nasceu com o objetivo de morrer e ressuscitar. O Salvador não morreria na cruz, na condição de gente de carne e ossos, se não houvesse nascido. E Ele só se manifestou em carne e ossos por causa do amor de Deus por nós, não veio passear na terra entre os pecadores. Então, considero importante usar um dia, dos 365 ou 366 de cada ano em que estamos vivos, para lembrar aos pecadores (eu me incluo como pecador) que Deus amou o mundo de tal maneira que entregou seu filho unigênito para nos salvar. 

Entendo que a regra de fé e comportamento do cristão é a Bíblia Sagrada. E assim, o cristão se orienta pela doutrina de Cristo, contida tanto no Antigo quanto no Novo Testamento. Podemos usar outra base como nossa regra de fé e conduta, além da Bíblia Sagrada? Não devemos fazer isso, porque é atitude de hereges e pagãos colocar outra palavra acima da Palavra de Deus. 

Então, se o nosso único Livro de regras e comportamento não aponta para nenhuma proibição contra a celebração do nascimento do Filho de Deus, como então afirmar que celebrar o Natal de Jesus Cristo é um costume anticristão? Como se posicionar contra a celebração do nascimento de Cristo se o próprio Cristo não se posiciona contra a celebração do seu nascimento? 

Sobre a data da celebração, não entendo que não saber o dia exato como um impeditivo à celebração. Não haver uma data no calendário apontando o dia exato ao nascimento é o que menos importa. Considero que o fator mais importante é usar um dia, usamos 25 de dezembro mas poderia ser outro dia. O importante é usar um dia como o momento de dizer ao mundo que Jesus é a prova do amor de Deus, destacar para muitos que Deus amou o mundo de tal maneira que entregou seu filho unigênito para nos salvar. A entrega que Deus fez significa a comprovação deste amor. 

Como adoradores de Deus e seguidores de Cristo precisamos imitar a Deus e a Cristo, em nossos relacionamentos interpessoais. Amar ao próximo, expressar em palavras este amor e ter a atitude condizente com esta declaração de amor. 

Quantos declaram amar o próximo e não comprova esta declaração através de ações ajustadas com o que diz? O Natal é uma lição de como precisamos ser como cristãos. Como? Menos discursos cheios de propostas e mais posicionamentos efetivos. 

Não consigo ligar o fato de se montar decorações natalinas em árvores com idolatria. Sabemos que comerciantes fazem isso com intenções de alavancar suas vendas... 

Que as famílias possam se reunir à roda da mesa e centralizar Jesus Cristo em seus corações. O mais relevante não é presunto, pratos requintados e trocas de presentes, é a união, a paz em família. Que a Ceia de Natal possa ser momento de reconciliação. A situação de harmonia parece ser situação tão difícil de ser alcançado na vida de muitos hoje em dia. Oremos, para que o clima de entendimento e concordância seja realidade na vida de todos nós, porque Jesus nasceu com o objetivo de morrer e ressuscitar e levar para o céu os pacificadores. 

A humanidade comemora essa data desde bem antes do nascimento de Jesus. Conheça o bolo de tradições que deram origem à festa. 

Roma, século 2, dia 25 de dezembro. A população está em festa, em homenagem ao nascimento daquele que veio para trazer benevolência, sabedoria e solidariedade aos homens. Cultos religiosos celebram o ícone, nessa que é a data mais sagrada do ano. Enquanto isso, as famílias apreciam os presentes trocados dias antes e se recuperam de uma longa comilança. 

Mas não. Essa comemoração não é o Natal. Trata-se de uma homenagem à data de “nascimento” do deus persa Mitra, que representa a luz e, ao longo do século 2, tornou-se uma das divindades mais respeitadas entre os romanos. Qualquer semelhança com o feriado cristão, no entanto, não é mera coincidência. 

A história do Natal começa, na verdade, pelo menos 7 mil anos antes do nascimento de Jesus. É tão antiga quanto a civilização e tem um motivo bem prático: celebrar o solstício de inverno, a noite mais longa do ano no hemisfério norte, que acontece no final de dezembro. Dessa madrugada em diante o sol fica cada vez mais tempo no céu, até o auge do verão. É o ponto de virada das trevas para luz: o “renascimento” do Sol. Num tempo em que o homem deixava de ser um caçador errante e começava a dominar a agricultura, a volta dos dias mais longos significava a certeza de colheitas no ano seguinte. E então era só festa. Na Mesopotâmia, a celebração durava 12 dias. Já os gregos aproveitavam o solstício para cultuar Dionísio, o deus do vinho e da vida mansa, enquanto os egípcios relembravam a passagem do deus Osíris para o mundo dos mortos. Na China, as homenagens eram (e ainda são) para o símbolo do yin-yang, que representa a harmonia da natureza. Até povos antigos da Grã-Bretanha, mais primitivos que seus contemporâneos do Oriente, comemoravam: o forrobodó era em volta de Stonehenge, monumento que começou a ser erguido em 3100 a.C. para marcar a trajetória do Sol ao longo do ano. 

A comemoração em Roma, então, era só mais um reflexo de tudo isso. Cultuar Mitra, o deus da luz, no 25 de dezembro era nada mais do que festejar o velho solstício de inverno – pelo calendário atual, diferente daquele dos romanos, o fenômeno na verdade acontece no dia 20 ou 21, dependendo do ano. Seja como for, o culto a Mitra chegou à Europa lá pelo século 4 a.C., quando Alexandre, o Grande, conquistou o Oriente Médio. Centenas de anos depois, soldados romanos viraram devotos da divindade. E ela foi parar no centro do Império. 

Mitra, então, ganhou uma celebração exclusiva: o Festival do Sol Invicto. Esse evento passou a fechar outra farra dedicada ao solstício. Era a Saturnália, que durava uma semana e servia para homenagear Saturno, senhor da agricultura. “O ponto inicial dessa comemoração eram os sacrifícios ao deus. Enquanto isso, dentro das casas, todos se felicitavam, comiam e trocavam presentes”, dizem os historiadores Mary Beard e John North no livro Religions of Rome (“Religiões de Roma”, sem tradução para o português). 

Os mais animados se entregavam a orgias – mas isso os romanos faziam o tempo todo. Bom, enquanto isso, uma religião nanica que não dava bola para essas coisas crescia em Roma: o cristianismo. 

Solstício cristão 

As datas religiosas mais importantes para os primeiros seguidores de Jesus só tinham a ver com o martírio dele: a Sexta-Feira Santa (crucificação) e a Páscoa (ressurreição). O costume, afinal, era lembrar apenas a morte de personagens importantes. Líderes da Igreja achavam que não fazia sentido comemorar o nascimento de um santo ou de um mártir – já que ele só se torna uma coisa ou outra depois de morrer. Sem falar que ninguém fazia ideia da data em que Cristo veio ao mundo – o Novo Testamento não diz nada a respeito. Só que tinha uma coisa: os fiéis de Roma queriam arranjar algo para fazer frente às comemorações pelo solstício. E colocar uma celebração cristã bem nessa época viria a calhar – principalmente para os chefes da Igreja, que teriam mais facilidade em amealhar novos fiéis. Aí, em 221 d.C., o historiador cristão Sextus Julius Africanus teve a sacada: cravou o aniversário de Jesus no dia 25 de dezembro, nascimento de Mitra. A Igreja aceitou a proposta e, a partir do século 4, quando o cristianismo virou a religião oficial do Império, o Festival do Sol Invicto começou a mudar de homenageado. “Associado ao deus-sol, Jesus assumiu a forma da luz que traria a salvação para a humanidade”, diz o historiador Pedro Paulo Funari, da Unicamp. Assim, a invenção católica herdava tradições anteriores. “Ao contrário do que se pensa, os cristãos nem sempre destruíam as outras percepções de mundo como rolos compressores. Nesse caso, o que ocorreu foi uma troca cultural”, afirma outro historiador especialista em Antiguidade, André Chevitarese, da UFRJ. 

Não dá para dizer ao certo como eram os primeiros Natais cristãos, mas é fato que hábitos como a troca de presentes e as refeições suntuosas permaneceram. E a coisa não parou por aí. Ao longo da Idade Média, enquanto missionários espalhavam o cristianismo pela Europa, costumes de outros povos foram entrando para a tradição natalina. 

A que deixou um legado mais forte foi o Yule, a festa que os nórdicos faziam em homenagem ao solstício. O presunto da ceia, a decoração toda colorida das casas e a árvore de Natal vêm de lá. Só isso. 

Outra contribuição do norte foi a ideia de um ser sobrenatural que dá presentes para as criancinhas durante o Yule. Em algumas tradições escandinavas, era (e ainda é) um gnomo quem cumpre esse papel. Mas essa figura logo ganharia traços mais humanos. 

Nasce o Papai Noel 

Ásia Menor, século 4. Três moças da cidade de Myra (onde hoje fica a Turquia) estavam na pior. O pai delas não tinha um gato para puxar pelo rabo, e as garotas só viam um jeito de sair da miséria: entrar para o ramo da prostituição. Foi então que, numa noite de inverno, um homem misterioso jogou um saquinho cheio de ouro pela janela (alguns dizem que foi pela chaminé) e sumiu. Na noite seguinte, atirou outro; depois, mais outro. Um para cada moça. Aí as meninas usaram o ouro como dotes de casamento – não dava para arranjar um bom marido na época sem pagar por isso. 

E viveram felizes para sempre, sem o fantasma de entrar para a vida, digamos, “profissional”. Tudo graças ao sujeito dos saquinhos. O nome dele? Papai Noel. 

Bom, mais ou menos. O tal benfeitor era um homem de carne e osso conhecido como Nicolau de Myra, o bispo da cidade. Não existem registros históricos sobre a vida dele, mas lenda é o que não falta. Nicolau seria um ricaço que passou a vida dando presentes para os pobres. Histórias sobre a generosidade do bispo, como essa das moças que escaparam do bordel, ganharam status de mito. Logo atribuíram toda sorte de milagres a ele. E um século após sua morte, o bispo foi canonizado pela Igreja Católica. Virou são Nicolau. 

Um santo multiuso: padroeiro das crianças, dos mercadores e dos marinheiros, que levaram sua fama de bonzinho para todos os cantos do Velho Continente. Na Rússia e na Grécia Nicolau virou o santo nº1, a Nossa Senhora Aparecida deles. No resto da Europa, a imagem benevolente do bispo de Myra se fundiu com as tradições do Natal. E ele virou o presenteador oficial da data. Na Grã-Bretanha, passaram a chamá-lo de Father Christmas (Papai Natal). Os franceses cunharam Pére Nöel, que quer dizer a mesma coisa e deu origem ao nome que usamos aqui. Na Holanda, o santo Nicolau teve o nome encurtado para Sinterklaas. E o povo dos Países Baixos levou essa versão para a colônia holandesa de Nova Amsterdã (atual Nova York) no século 17 – daí o Santa Claus que os ianques adotariam depois. Assim o Natal que a gente conhece ia ganhando o mundo, mas nem todos gostaram da ideia. 

Natal fora-da-lei 

Inglaterra, década de 1640. Em meio a uma sangrenta guerra civil, o rei Charles 1º digladiava com os cristãos puritanos – os filhotes mais radicais da Reforma Protestante, que dividiu o cristianismo em várias facções no século XVI. 

Os puritanos queriam quebrar todos os laços que outras igrejas protestantes, como a anglicana, dos nobres ingleses, ainda mantinham com o catolicismo. A ideia de comemorar o Natal, veja só, era um desses laços. Então precisava ser extirpada. 

Primeiro, eles tentaram mudar o nome da data de “Christmas” (Christ’s mass, ou Missa de Cristo) para Christide (Tempo de Cristo) – já que “missa” é um termo católico. Não satisfeitos, decidiram extinguir o Natal numa canetada: em 1645, o Parlamento, de maioria puritana, proibiu as comemorações pelo nascimento de Cristo. As justificativas eram que, além de não estar mencionada na Bíblia, a festa ainda dava início a 12 dias de gula, preguiça e mais um punhado de outros pecados. 

A população não quis nem saber e continuou a cair na gandaia às escondidas. Em 1649, Charles 1º foi executado e o líder do exército puritano Oliver Cromwell assumiu o poder. As intrigas sobre a comemoração se acirraram, e chegaram a pancadaria e repressões violentas. A situação, no entanto, durou pouco. Em 1658 Cromwell morreu e a restauração da monarquia trouxe a festa de volta. 

Mas o Natal não estava completamente a salvo. Alguns puritanos do outro lado do oceano logo proibiriam a comemoração em suas bandas. 

Foi na então colônia inglesa de Boston, onde festejar o 25 de dezembro virou uma prática ilegal entre 1659 e 1681. O lugar que se tornaria os EUA, afinal, tinha sido colonizado por puritanos ainda mais linha-dura que os seguidores de Cromwell. Tanto que o Natal só virou feriado nacional por lá em 1870, quando uma nova realidade já falava mais alto que cismas religiosas. 

Tio Patinhas 

Londres, 1846, auge da Revolução Industrial. O rico Ebenezer Scrooge passa seus Natais sozinho e quer que os pobres se explodam “para acabar com o crescimento da população”, dizia. Mas aí ele recebe a visita de 3 espíritos que representam o Natal. Eles lhe ensinam que essa é a data para esquecer diferenças sociais, abrir o coração, compartilhar riquezas. E o pão-duro se transforma num homem generoso. 

Eis o enredo de Um Conto de Natal, do britânico Charles Dickens. O escritor vivia em uma Londres caótica, suja e superpopulada – o número de habitantes tinha saltado de 1 milhão para 2,3 milhões na 1a metade do século 19. Dickens, então, carregou nas tintas para evocar o Natal como um momento de redenção contra esse estresse todo, um intervalo de fraternidade em meio à competição do capitalismo industrial. Depois, inúmeros escritores seguiram a mesma linha – o nome original do Tio Patinhas, por exemplo, é Uncle Scrooge, e a primeira história do pato avarento, feita em 1947, faz paródia a Um Conto de Natal. Tudo isso, no fim das contas, consolidou a imagem do “espírito natalino” que hoje retumba na mídia. Quer dizer: quando começar o próximo especial de Natal na televisão, pode ter certeza de que o fantasma de Dickens vai estar ali. Outra contribuição da Revolução Industrial, bem mais óbvia, foi a produção em massa. Ela turbinou a indústria dos presentes, fez nascer a publicidade natalina e acabou transformando o bispo Nicolau no garoto-propaganda mais requisitado do planeta. 

Até meados do século 19, a imagem mais comum dele era a de um bispo mesmo, com manto vermelho e mitra – aquele chapéu comprido que as autoridades católicas usam. Para se enquadrar nos novos tempos, então, o homem passou por uma plástica. 

O cirurgião foi o desenhista americano Thomas Nast, que em 1862, tirou as referências religiosas, adicionou uns quilinhos a mais, remodelou o figurino vermelho e estabeleceu a residência dele no Polo Norte – para que o velhinho não pertencesse a país nenhum. Nascia o Papai Noel de hoje. Mas a figura do bom velhinho só bombaria mesmo no mundo todo depois de 1931, quando ele virou estrela de uma série de anúncios da Coca-Cola. A campanha foi sucesso imediato. Tão grande que, nas décadas seguintes, o gorducho se tornou a coisa mais associada ao Natal. Mais até que o verdadeiro homenageado da comemoração. Ele mesmo: o Sol. 

O Significado Permanente do Natal 

O anúncio do nascimento de Jesus é o ponto inicial do Plano de Salvação que Deus formou para a humanidade. Por isso devemos pregar sobre o Natal, independente da data. Infelizmente o significado do Natal foi corrompido pelo comércio e tradições que celebram de tudo, menos a vinda do Salvador ao mundo. 

Já imaginou se na história bíblica não houvesse o fato do nascimento de Jesus? Ficaria faltando um ponto principal no plano de salvação. Então, se deixarmos de falar sobre isso, omitimos algo que a Bíblia fez questão de relatar com detalhes para nos mostrar o significado deste momento. 

O Natal deve ser um tempo para a família estar juntos, mas é imprescindível a presença de Jesus. Celebrar o Natal sem falar de Jesus seria como ir a uma festa de aniversário sem o aniversariante. Aproveite este momento para anunciar a salvação em Jesus para sua família. 

Qual é o significado do Natal? 

Vamos aprender com a profecia de Isaías sobre o nascimento de Jesus, qual é o significado permanente do Natal: 

1- Luz: “o povo que andava em trevas viu grande luz” 

Isaías declara de maneira profética que quando o Messias viesse haveria luz para aqueles que estavam em trevas. Até a vinda de Jesus ao mundo, a humanidade vivia em escuridão e temor, mas desde que nasceu trouxe “a verdadeira luz que vinda ao mundo, ilumina todo homem” (Lucas 1.9). A luz de Jesus é o maior brilho do Natal. 

Natal é um tempo de luz não por causa das milhares de lâmpadas que enfeitam as cidades e sim porque Jesus é o Salvador e esta boa notícia deve ser anunciada como oportunidade gratuita aqueles que viviam sem esperança. Este período é uma oportunidade de falar das Boas Novas levando luz às pessoas ao nosso redor. Aproveite o Natal para levar Luz às pessoas que não conhecem a Jesus! 

2- Alegria: “tens multiplicado este povo, a alegria lhe aumentaste” 

O texto cita a palavra alegria três vezes apenas neste versículo. O profeta Isaías imagina o dia da vinda do Messias como o dia mais alegre que já houvesse em todos os tempos. Contudo não é uma alegria passageira e sim algo que aumenta a cada instante. 

Lamentavelmente criou-se um paradigma sobre o Natal em que a alegria se baseia nas festas. Entretanto muitas pessoas passam esta data de maneira triste e solitária ficando desiludidos. A alegria do Natal deve ser muito além de tudo isso. Ao invés de nos alegrarmos por ter comida farta, roupas novas e presentes, podemos também nos alegrar ao abençoar aqueles que não têm condições para isso visitando aqueles que estão enfermos, órfãos, idosos e pessoas desamparadas. Neste Natal leve alegria para pessoas que estão sofrendo! 

3- Justiça: “tu quebraste o jugo que pesava sobre eles” 

O profeta Isaías expressa estas palavras como um alívio de quem estaria sentindo dores. O povo de Deus havia passado por tantas lutas e dominado por tantos imperadores cruéis que não aguentavam mais a injustiça. 

A vinda do Messias traria então a justiça definitiva que tanto esperavam e acabaria com as guerras chegando até a queimar as ‘botas do guerreiro’ e as ‘vestes sujas de sangue’ para não deixar nem lembrança das injustiças do passado. 

Antes de gastar com festas precisamos pensar se temos contas a pagar para não acumular dívidas injustas para o próximo ano. Também podemos desfazer de ‘botas e vestes’ que não nos servem mais para ajudar quem estiver precisando. Fazer justiça é fazer coisas corretas e honestas, além de recompensar quem precisa de ajuda. Natal é tempo de fazer justiça! 

4- Paz: “Príncipe da paz; para que se aumente o seu governo e venha paz sem fim” 

Durante séculos de guerras intercaladas por períodos breves de paz, o profeta Isaías anuncia que chegaria um tempo de “paz sem fim” porque viria aquele que é o Príncipe da Paz. Não existe notícia mais bonita do que esta. Como uma bandeira branca estendida para anunciar o fim da batalha, o Evangelho anuncia a paz para quem está sofrendo. 

No mundo existem mais de sete bilhões de pessoas que estão lutando todos os dias e procuram paz para suas vidas. A cada dia uma nova luta ou dificuldade a ser vencida. Estas vidas precisam de alguém que lhes anuncie a paz e que sua luta foi terminada pelo Príncipe da Paz que veio ao mundo para dar tranquilidade ao seu coração, mesmo diante das dificuldades da vida. Também é uma oportunidade de acabarmos com as guerras e perdoar nossos inimigos para que haja paz. Natal é o momento de declarar paz! 

Celebre o Natal Verdadeiro! 

“Porque o Reino de Deus não é comida nem bebida, mas justiça, e paz, e alegria no Espírito Santo”. Rm. 14.17 

Não deixe que o Natal se resuma numa festa comum. Jesus não veio ao mundo para que marcássemos uma data especial em nosso calendário (talvez seja por isso que não nos permitiu saber que dia nasceu. Nem mesmo para que façamos uma mesa farta de comidas e bebidas. Ele veio ao mundo para trazer sua Luz, sua Alegria, Justiça e Paz. 

A festa do Natal se torna mais bela e quando sabemos seu verdadeiro significado. A presença de Jesus é a condição fatal para que o Natal seja verdadeiro. Jesus deixou claro que estaria presente através “dos pequeninos”, então devemos procurar ajudar as pessoas neste momento. 

O Natal significa anunciar a Luz de Jesus para quem vive nas trevas sem esperança. Alegria para quem está sofrendo. Justiça para quem está sendo injustiçado. E Paz para todos que estão lutando. Celebre o Natal verdadeiramente! 

Fontes: 

Eliseu Antonio Gomes (https://belverede.blogspot.com/)

Pr. Welfany Nolasco Rodrigues 

Alexandre Versignassi e Thiago Minami
access_time22 dez 2017, 20h19 - Publicado em 30 nov 2006, 22h00
https://super.abril.com.br/historia/a-verdadeira-historia-do-natal/

terça-feira, 4 de dezembro de 2018

Procura-se um Homem...

Ez. 22,30, começa fazendo a seguinte afirmação: “Busquei entre eles um homem...”. 

Surge então a primeira pergunta: Por que Deus procura um homem? Para entender melhor essa pergunta, precisamos olhar para o contexto da profecia. 

Ezequiel está falando para uma cidade completamente coberta pelo pecado. Para um povo que escolheu viver distante de Deus. Jerusalém estava vivendo momentos de intensas abominações, e isso incomodava o coração de Deus de maneira que Ele precisava intervir pela sua justiça e pelo seu amor. Jerusalém havia se tornado numa “Sodoma” irrecuperável e assim como foi com aquela cidade do tempo de Abraão, cuja prática do pecado era tão grave a ponto de se levantar um clamor cósmico reivindicando a justiça divina contra ela, também agora estava sendo com Jerusalém. 

O texto acima referido contém uma lista de pecados praticados por uma geração que viveu entre os anos 593 e 571 a. C. Que não só lembra a Sodoma de outrora como bem poderia ser confundida com os dias de hoje. 

Jerusalém aqui é apresentada como uma sociedade sanguinária. Matar homens inocentes havia se tornado esporte para uns, e comércio para outros. Assassinos eram contratados para que os poderosos não sujassem as mãos de sangue, (II Reis 21.6; 24.4). 

Havia injustiça Social por toda parte afetando diretamente a instituição base da sociedade que é a família. Os pais eram desprezados pelos próprios filhos e as viúvas e os órfãos pelos parentes e pelo governo. Homens davam falsos testemunhos promovendo o derramamento de sangue. Perversidade sexual; Prostituição, adultério, incesto. Extorsão, suborno, usura. Lucros excessivos, desonestidade, roubo. Exploração por toda parte e o que é pior: Desprezaram a Deus. 

Uma geração que virou as costas para Deus e passou a praticar o sincretismo religioso transformando os cultos em ambiente até mesmo de conspirações. Acaso teria alguma diferença do mundo de hoje? Entende agora por que Deus procura um homem? 

Sempre que uma geração se afasta dos caminhos do Senhor e se volta para os próprios caminhos, e seus pecados se tornam gritantes diante de Deus, Ele procura alguém com quem possa contar para combater o pecado. “Busquei entre eles um homem...” 

Mas, qual é o TIPO de homem que Deus procura? “...um homem”. Isso nos enche de consolo e de expectativa. A história nos mostra que os homens que Deus usou para realizar a sua vontade era gente de carne e osso como eu e como você. Gente tão humana que foi preciso encorajá-la muitas vezes. 

Moisés, escolhido por Deus para libertar Israel dos egípcios, se sentia incapaz. A Josué Deus precisou dizer: “ser forte e corajoso, ...”. Assim foi com Gideão, Davi, Jonas, Neemias e muitos outros. O medo, a covardia, a dúvida, a insegurança, a incerteza, a fraqueza, o cansaço, o desânimo, a perda, o luto, a dor e até mesmo a fuga fizeram parte da vida desses líderes heróis. Porém, através deles Deus fez histórias. Logo entendemos que esse homem pode ser alguém como eu ou você. Aleluia!! 

PARA que Deus procura um homem? Para “...ficar na brecha..”. 

Qualquer cidade com brecha no muro, significa perigo iminente! Ezequiel usa essa metáfora para denunciar a falta de compromisso com a Palavra de Deus. O sincretismo religioso passou a fazer parte dos seus cultos. O liberalismo tornou-se moda e as pessoas viraram as costas para Deus. O relacionamento estava quebrado como uma brecha num muro de proteção. 

Quando o muro da retidão está abalado pela brecha da maldade, a justiça divina prevê juízo (Salmo 89.14). Todavia em se tratando de Deus, a misericórdia triunfará sobre o juízo (Miquéias 7.18), sempre que a brecha for tapada. 

Aqueles (os profetas) que deviam denunciar o pecado da nação e desafiá-la ao arrependimento, isto é, construírem os muros de proteção moral e espiritual de Jerusalém, contribuíram para o caos espiritual de Jerusalém. Ez. 13.5; Jo 10.12. 

Deus procurava alguém que pudesse tapar os muros. Deus continua procurando homens que estejam dispostos a denunciar a imoralidade, a corrupção, a desonestidade e a idolatria da sociedade de hoje. Este alguém pode ser você. 

Deus procurava alguém que pudesse ficar na brecha. Alguém que tivesse uma postura intercessória que “convencesse” a Deus de que valia a pena retirar o juízo. 

Jesus ensinou essa tarefa aos seus discípulos. Mt. 26.41. 

Abraão intercedeu pelos justos de Sodoma Gn. 18.22-33. 

Moisés intercedeu várias vezes pelo povo de Deus Êx. 32. 11-14; Nm.16.48. 

Neemias fez o mesmo por Israel. 

Deus também espera que alguém esteja disposto a fazer o mesmo nos dias de hoje. Por isso Deus continua procurando um homem que possa tapar o muro e ficar na brecha perante Ele a favor de... 

Sabendo o que significa tapar os muros e ficar nas brechas... e conhecendo a realidade do mundo de hoje, qual tem sido a nossa atitude diante do desafio de Deus para nossas vidas? 

Qual tem sido a resposta que você tem dado ao Senhor durante todo esse tempo? 

Deus continua procurando um homem! O desafio em nossa volta, visto da nossa perspectiva, parece ser insolúvel. A realidade da sociedade que aí está, nos faz sentir impotente. 

Mas, pela ótica divina, entendemos que Ele só precisa de um homem para fazer a diferença. Um homem totalmente disponível ao Senhor. Um homem que esteja disposto a ficar na brecha. 

quarta-feira, 28 de novembro de 2018

Estão Brincando de Deus!

Gn. 2,7: “E formou o Senhor Deus o homem do pó da terra, e soprou em suas narinas o fôlego da vida”. 

E, então, o homem adquiriu conhecimento, simulou os instantes após o Big Bang (a explosão cósmica que originou o universo), produziu cópias idênticas de animais, descobriu células capazes de originar outros órgãos, criou uma célula viva com um genoma artificial. 

Para muitos religiosos, ele agora brinca de ser Deus. Bactérias e Arqueas estão entre os organismos mais primitivos conhecidos pelo Homem. Não tanto quanto comentaristas de portal, mas quase. Essas criaturinhas unicelulares não possuem núcleo ou organelas individuais bem definidas, e para piorar ainda mais suas vidas são alvos de ataques implacáveis de vírus, mas eles não estão indefesos, não senhor. Tio Darwin deu a elas uma arma chamada CRISPR!




Quando um vírus invade uma bactéria ou uma célula, ele injeta seu DNA (ou RNA) e como são burros, os mecanismos de replicação da célula começam a reproduzir o DNA do vírus, que é decodificado, produzindo proteínas e no final a célula explode liberando milhares de cópias do vírus. Mas nem tudo está perdido, nosso primitivo organismo tem defesas, conseguidas a duras penas depois de muito evoluir.

Assim que o DNA do vírus entra na célula, uma família de proteínas chamadas Cas1 identificam o DNA invasor e recortam um pedaço dele, pegando o que seria uma “assinatura” do vírus. Essa assinatura é incorporada no DNA da célula invadida, que em seguida aciona uma enzima chamada Cas9. Ela carrega uma sequência de DNA com uma cópia do DNA do vírus.

Quando ela encontra o DNA viral, e compara com a sequência em memória, se forem iguais ela irá cortar fisicamente o DNA do vírus, inutilizando-o.

Agora a beleza da coisa: Como a sequência de bases nucleicas do DNA viral fica gravada no código genético da bactéria invadida, da próxima vez que outro vírus do mesmo tipo tentar atacar a célula, dará de cara com um monte de enzimas Cas9 armadas e engatilhadas prontas pra cortar seu barato.

O processo já foi inclusive observado em vídeo, fruto de uma pesquisa da Universidade Kanazawa e da Universidade de Tóquio:




O termo CRISPR (clustered regularly interspaced short palindromic repeats) apareceu pela primeira vez em 2001, em um paper de Francisco Mojica e Ruud Jansen, mas a primeira observação da coisa foi feita em 1987 por Yoshizumi Ishino, da Universidade de Osaka.

Ele estava estudando um gene chamado iap, ligado a morte celular, quando reparou que em várias partes do genoma da bactéria E.Coli, apareciam sequências repetidas e palindrômicas, em blocos pequenos. Elas eram chamadas palindrômicas porque podiam ser lidas da mesma forma em ambas as direções, como a clássica frase: “Socorram-me subi no onibus em Marrocos”

Assim uma sequência dessas poderia ser:
AGTTCAAGTCACAACACTGAACTTGA

Essas sequências palindrômicas eram separadas por sequências de DNA que foram chamadas de espaçadores, e em 1993 foi detectada a replicação desses espaçadores dentro dos organismos.


Em 2001 Mojica e Jansen estavam pesquisando a função das sequências palindrômicas e espaçadores, e graças a um software escrito por um aluno de Mojica, encontraram sequências palindrômicas em 20 espécies de micro-organismos.

Mais adiante Jansen descobriu que sempre que havia uma sequência de espaçadores e palíndromos, ela era antecedida por genes de proteínas cas. Em seguida um preâmbulo, e então começaram a sequência de palíndromos, com 28 a 37 bases nucleicas, e entre eles os espaçadores, com 32 a 38 bases.

Em 2005 Mojica e outros colegas publicaram um paper de título “Intervening sequences of regularly spaced prokaryotic repeats derive from foreign genetic elements“. Eles descreveram com identificaram nos espaçadores do DNA das bactérias sequências genéticas presentes em vírus bacteriófagos. Estava evidente de que havia uma relação entre CRISPR e um sistema imunológico das bactérias, e mais alguns anos de pesquisa e o modelo todo foi desvendado.


É em essência algo incrivelmente simples de entender: O mecanismo de defesa da bactéria guarda pedaços do DNA de vírus malignos, produz uma enzima chamada Cas9 que carrega uma sequência de RNA baseada no DNA maligno. A enzima escaneia toda molécula de DNA que encontra. Se acha uma sequência que combina com a que tem armazenada, aciona uma tesoura molecular que literalmente corta ao meio a molécula, naquele exato e preciso ponto.
Bingo!

Até então as técnicas CRISPR eram um pouco mais complicadas do que eu descrevi, na verdade a cas9 precisa de duas moléculas de RNA, uma que faz a identificação do DNA-alvo, e outra que contém o padrão a ser identificado. Aí em 2012 tudo mudou graças a essas duas moças:


Elas são Jennifer Doudna e Emmanuelle Charpentier. Manu é bioquímica, microbióloga e geneticista. Estudou na Universidade Pierre e Marie Curie, no Instituto Pasteur e fez pós-doutorado na Universidade Rockefeller nos EUA. Hoje ela é diretora do Instituto Max Planck na Alemanha.

A loura é a Jennifer Doudna, americana bioquímica com pós-doutorado na Universidade de Boulder, Colorado. Juntas eles revolucionaram a genética molecular quando conseguiram unificar as duas sequências de RNA da cas9, simplificando extremamente um processo que já era bem mais simples que os métodos tradicionais de manipulação genética.
Cut… and Paste!

Células têm mecanismos de reparo quando DNA é danificado, elas tentam reconectar as partes cortadas, mas se uma sequência de bases foi removida, o resultado é um gene com defeito, não-funcional.

Entretanto é possível usar CRISPR pra cortar um pedaço específico de DNA, e ao mesmo tempo você satura a área com templates de reparo, sequências curtas de DNA que se encaixam nas pontas das partes removidas. Os mecanismos de reparo da célula preferem essas partes, e vão colá-las no lugar do pedaço removido.


CRISPR pode ser usado para desativar genes específicos, e até cromossomos inteiros, é possível usar versões da cas9 com a tesoura molecular desativada, então ela encontra a sequência específica, se prende naquele lugar e interfere com o processo da célula de ler aquela informação. Pra todos os efeitos o gene está desativado, sem que o DNA seja danificado.
As Aplicações

Anemia Falciforme é uma doença muito cruel, que afeta 2% das crianças nascidas na África subsaariana, região que concentra 2/3 dos portadores. É uma condição genética incurável que mata 150 mil pessoas por ano e prejudica a qualidade de vida de todo mundo que sobrevive. Ela é causada por uma molécula de hemoglobina defeituosa, culpa de uma β-globina capenga.

Essa β-globina defeituosa é especificada no cromossomo 11, e o defeito é uma única base nucleica, que originalmente deveria ser GAG (guanina adenina guanina) mas por uma mutação virou GTG (guanina timina guanina).

Com CRISPR seria trivial consertar essa falha em um espermatozoide, óvulo ou mesmo um embrião.

XY, é um menino, ao menos até descobrir o Tumblr.

Indo além, se podemos desabilitar um cromossomo inteiro, isso seria uma cura completa para doenças como Síndrome de Down. Talvez seja possível até fazer isso com o organismo já formado, mas ninguém sabe como um ser vivo reagiria a uma mudança dessas.

CRISPR está sendo estudada como alternativa para fibrose cística, esclerose múltipla e uma penca de outras doenças sérias de origem genética, mas não pára aí.

Podemos imunizar organismos úteis, como as que usamos para profundir cerveja ou insulina (primeiro os da cerveja, please). Podemos remover retrovírus e genes que causam rejeição de órgãos transplantados.
O que já conseguimos

A técnica está sendo usada em organismos unicelulares e até em espécies mais complexas. Cientistas chineses usaram CRISPR para desativar o cromossoma Y em zigotos de ratos, que foram transplantados para ratas de aluguel, e se desenvolveram em lindas ratinhas. Isso mesmo, mudaram o sexo do bicho.

Eles também testaram células-tronco humanas com Down, desativando o cromossoma 21 extra.

Leitões sofrem muito com duas doenças virais, gastroenterite (causada pelo vírus TGEV) e diarréia, causada pelo PEDV. Essas doenças causam um prejuízo anual de US$600 milhões aos criadores americanos.

Randall Prather, da Universidade do Missouri e Bob Rowland, da Kansas State University descobriram que o trabalho dos vírus era facilitado por uma proteína chamada ANPEP. Eles identificaram o gene que expressa essa proteína, programaram sua localização no CRISPR e modificaram embriões para que os futuros porquinhos não mais produzissem a tal proteína.

As ninhadas nasceram, e os porcos foram contaminados com os dois vírus. Eles ainda sofreram de diarréia, mas não tinham nem sinal da gastroenterite e o TGEV não foi detectado nas fezes. Fora isso os porquinhos estavam lindos felizes e perfeitamente normais, ao menos até serem sacrificados para uma necrópsia detalhada. Yay Science!

A pesquisa foi publicada no paper Resistance to coronavirus infection in amino peptidase N-deficient pigs.

A lista de experimentos envolvendo CRISPR é imensa e promissora, mas a grande surpresa aconteceu por esses dias, quando cientistas chineses liderados por He Jiankui, da Southern University of Science and Technology, em Shenzhen anunciaram que usaram CRISPR para editar o DNA de duas meninas, gêmeas chamadas Lulu e Nana.

Segundo eles a modificação foi copiar uma mutação bem rara chamada CCR5-Δ32. As poucas pessoas que têm essa mutação são imunes ao HIV. Isso foi descoberto quando o sujeito mais azarado do mundo se tornou o mais sortudo. O coitado já tinha AIDS, e pra piorar desenvolveu leucemia. Depois da quimio precisou de um transplante de medula para recuperar o sistema imunológico, que não funcionaria muito bem, because AIDS.

Só que o doador tinha a mutação CCR5-Δ32. A carga viral do sujeito começou a cair, depois de 600 dias atingiu níveis indetectáveis. Ele foi acompanhado por mais seis anos, ao final dos quais foi declarado curado, HIV-Negativo e agora as únicas preocupações dele são gonorréia e pensão alimentícia.
E quais os problemas?

É muito mais complicado usar CRISPR em organismos complexos, nós somos ótimos em evitar que coisas indesejadas entrem em nossas células, o irônico é que a técnica mais eficiente para invadir uma célula humana e despejar a cas9, o RNA com o padrão e os templates de reparo é usando… um vírus. Isso causa uma resposta desbalanceada, e o sistema imunológico não gosta de vírus.

Esse aliás é o grande problema: As moléculas usadas no CRISPR são kibadas de organismos como o Staphylococcus aureus e o Streptococcus pyogenes, e nosso sistema imunológico detesta esses caras. Quando sente o cheiro, aciona linfócitos pra matar esmagar destruir, e nisso matam as células junto, numa taxa de 80%.

Em um estudo publicado na Nature, 79% dos humanos testados apresentaram anticorpos contra a cas9 do Staphylococcus aureus, e 65% contra a da Streptococcus pyogenes.

Streptococcus pyogenes

Há pesquisas que conseguiram alterar as enzimas a ponto de não gerarem resposta imunológica, mas não se sabe o quanto isso afeta sua eficiência, e aí caímos no outro problema:

CRISPR às vezes não funciona. Como tudo em biologia, nada é perfeito. Um paper publicado na Nature escrito por Michael Kosicki, Kärt Tomberg e Allan Bradley intitulado Repair of double-strand breaks induced by CrIsPr–Cas9 leads to large deletions and complex rearrangements alerta para danos extensos no genoma, com deleção em alguns casos de milhares de bases.

Aparentemente o mecanismo de correção nas células não faz milagres, e nem sempre pega o template de inserção correto, cola de qualquer jeito o DNA e o resultado é um trabalho porco. E câncer, claro. Essas coisas sempre resultam em câncer.

As próprias criadoras da técnica, Jennifer Doudna e Emmanuelle Charpentier estão pedindo uma moratória em pesquisas envolvendo humanos, dizem que é muito cedo, sabemos muito pouco ainda sobre os detalhes e consequências do CRISPR, e técnicas que afetem a estrutura genética de organismos, e consequentemente sejam repassadas para a prole devem ser tratadas com o máximo de cuidado e temeridade.
Considerações Éticas

Essas são as preferidas dos filósofos e palpiteiros, se me permite o pleonasmo. Dizem que o Homem não pode brincar de Deus, mas vou contar um segredo: O Homem já brinca de Deus desde 1767, quando a Sociedade Para Recuperação de Pessoas Afogadas foi fundada na Holanda, e criou os primórdios da Reanimação Cardiopulmonar, embora eu reconheça que estimular o afogado com fumaça de tabaco no ânus não seja mais prática tão comum.

Em quatro anos eles salvaram 150 pessoas, pelo simples fato de não aceitaram a morte como inevitável.

Quando Louise Brown foi apresentada ao mundo em 1978, a reação foi extremamente variada e extremamente radical.


Fruto da primeira fertilização in-vitro bem-sucedida, Louise era vista por uns como um milagre da ciência, mas outros a achavam uma abominação, cientistas hereges estariam desafiando Deus determinando eles o momento da concepção. O Vaticano protestou e houve até gente dizendo que Louise não teria alma, por ter sido concebida à revelia de Deus.

Hoje em dia bebê de proveta é algo tão comum, tão mundano que as pessoas nem comentam mais se são fruto de fertilização in-vitro, é algo que tem zero estigma social.

Os argumentos de que CRISPR pode gerar uma série de “bebês projetados” também não colam. Os pais vão escolher que querem bebês mais inteligentes, com menos predisposição a doenças, e qual o problema? Será que escolherem a cor dos olhos é um preço tão alto para ninguém mais nascer com uma bomba-relógio em seus genes, aguardando a hora de desencadear Huntington, esclerose múltipla, Alzheimer ou vegetarianismo?

Hoje já fazemos seleção genética de embriões para fertilização in-vitro, e mesmo durante a gravidez, através de análise do líquido amniótico. Quem pode já escolhe até o sexo do bebê.


A ideia de que CRISPR criará uma raça de mutantes, o homo superior, enquanto o resto do mundo permanecerá na obscuridade é uma bobagem. Ciência não funciona assim, as tecnologias se aprimoram e se barateiam. Aquele Raio-X que qualquer dentista de subúrbio tem era algo restrito a gente muito rica no começo do Século XX. Fertilização in-vitro? No Brasil custa R$11 mil, ou você pode fazer pelo SUS. E se você acha que é algo ainda assim restrito, até em Uganda fazem fertilização in vitro.

SE o CRISPR se tornar a técnica que todos esperamos, acontecerá o de sempre: Inicialmente os tratamentos serão caros, com o tempo se tornarão mais em conta e no final você comprará em farmácia. Nos Anos 80 o Fantástico anunciou a Cura do Câncer (ok eles anunciam toda semana), o Interferon, uma droga mágica que custava milhões.

Não era a cura definitiva mas se mostrou um excelente antiviral, usado para doenças como hepatite, controle de tumores e viroses de verdade, daquelas que nada mais adianta. Quanto custa? R$256,00.

Conclusão

CRISPR pode salvar o mundo, mas se o fizer não será hoje. CRISPR é uma ferramenta que nos permite encontrar imediatamente um trecho em qualquer livro de uma biblioteca, mas estão todos escritos em um idioma que quase não entendemos. CRISPR é a técnica mais promissora para controlarmos o destino genético da vida na Terra, mas também pode ser que fique restrito a casos específicos, talvez a complexidade de lidar com organismos inteiros seja grande demais.


A única certeza é que nem tão cedo teremos super-bebês, nem infelizmente a cura de um monte de doenças. A ciência responsável não se precipita, já tivemos erros demais, como a Talidomida. No máximo CRISPR só será boa notícia a curto prazo se você for um porco, e não tiver ouvido falar em feijoada.


E os direitos da vida humana desde a sua concepção, onde é que ficam? A clonagem é condenada pela Igreja e por qualquer pessoa de bom senso. Manipula um embrião, com altos riscos de deformação para o nascituro. E a clonagem para fins terapêuticos, que trata o embrião como material biológico descartável, merece todo nosso repúdio.



A vida humana é sagrada. Ninguém pode manipulá-la, instrumentalizá-la, eliminá-la. A vinda de uma pessoa ao mundo não é uma realidade apenas biológica. É um evento biológico, psíquico e espiritual. Toca o próprio poder criador de Deus. Não dá para os homens ficarem assim brincando de Deus.

Fonte:
https://meiobit.com

sexta-feira, 23 de novembro de 2018

A Família de Estéfanas

“Porque trouxeram refrigério ao meu espírito e ao vosso. Reconhecei, pois, a homens como estes” 1Cor 16.18

Estéfanas foi um membro da igreja de Corinto, cuja família se encontrava entre aqueles que os apóstolos batizaram. Alguns pensam que ele é o “carcereiro de Filipos”. A primeira epístola aos Coríntios foi escrita em Filipos cerca de seis anos depois da conversão do carcereiro e ele encontrava-se ali com o apóstolo nessa altura.

Estéfanas e sua família foram os primeiros convertidos na cidade de Corinto, a capital da província da Acaia. Eles, desde o início da caminhada cristã, consagraram-se ao serviço dos santos. Eram não apenas cooperadores, mas também obreiros. Não apenas ajudaram o apóstolo Paulo durante sua estada em Corinto, mas depois que ele saiu, continuaram trabalhando com o mesmo empenho e consagração. Nas horas mais amargas do apóstolo Paulo em Éfeso, quando enfrentou feras e tribulações maiores do que suas forças, a ponto de quase desesperar-se da própria vida, Paulo recebe a visita de Estéfanas, acompanhado de Fortunato e Acaico.

Esses trouxeram grande alegria para Paulo. Supriram o apóstolo de tudo aquilo que os crentes de Corinto deixaram de fazer. Esses três irmãos trouxeram refrigério ao espírito de Paulo nos dias mais sombrios de sua vida. O apóstolo dos gentios ordena a igreja a reconhecer e a honrar sempre homens dessa estirpe.

Estéfanas e sua família são o alvo destes versículos na carta de Paulo. Em poucas palavras, ele revela pontos importantes sobre essas pessoas, que nos trazem grandes lições.

Primeiramente, Estéfanas e sua casa foram as “primícias” da Acaia, quer dizer, foram os primeiros a se converterem ao Evangelho nesta região da Grécia. Foram uns dos poucos que Paulo batizou pessoalmente. Estéfanas e sua família eram as primícias, ou seja, os dízimos de Deus naquela região.

Isso é interessante pois Deus fala na Bíblia que o Seu povo é Suas primícias. Os que são fiéis a Ele são vistos por Ele como especiais. 

Muitos ouviram o Evangelho em Acaia juntamente com Estéfanas. Mas ele e sua casa foram os primeiros a reagir positivamente e se converterem. Isso mostra uma prontidão, disponibilidade, entrega sem reservas e sem rodeios… se lançar de cabeça. Muitos demoram para se converter, mas acabam se convertendo depois de um longo processo. Amém. Antes assim. Mas os do tipo de Estéfanas são os que se entregam sem demora. Por que adiar nossa entrega para Deus? Só mesmo quem quer correr o risco de não ser salvo, pois nunca sabemos quando partiremos desta vida.

Talvez você seja o primeiro a se converter na sua família; o primeiro a decidir se batizar nas águas; o primeiro a receber o Espírito Santo entre seus amigos; o primeiro a deixar tudo para fazer a Obra de Deus na sua igreja; ou o primeiro a se entregar para Deus depois de ler esta mensagem. Só depende de você.

O certo é que há um valor muito especial para Deus quando alguém é o primeiro a dizer “sim” para Ele, a servi-lo, a fazer algo por Ele. Não seja devagar nas suas decisões de servir a Deus. Seja sempre o primeiro a se prontificar. Esta é a primeira lição que aprendemos com Estéfanas.

Paulo costumava deixar outros discípulos batizarem as pessoas. Note, porém, como esta “exceção”, o fazer algo que não fazia normalmente, rendeu grande lucro ao Evangelho mais tarde. Estéfanas e sua casa se tornaram fiéis discípulos. Às vezes temos que fazer o que não costumamos fazer para obter resultados que não costumamos ter.

Você tem sido uma fonte de refrigério para os aflitos? Tem cooperado com a obra de Deus? Tem encorajado os obreiros de Deus? Tem se empenhado em visitar as pessoas aflitas para levar a elas uma palavra de consolo? Coloque sua vida e sua casa nas mãos de Deus!

terça-feira, 13 de novembro de 2018

Tosquiadores de Ovelhas

Toda ovelha chega a uma época que a sua lã cresce; e cresce muito. O crescimento da sua lã acaba por lhe trazer alguns problemas que precisam ser tratados: fica pesada demais e tem dificuldade de se movimentar e fica vulnerável aos carrapichos e outras pragas da vegetação. 


Sabendo disso, o seu pastor prepara-se para um momento muito importante. Importante para a ovelha e importante também para ele, pois a lã que será tirada da ovelha lhe servirá de sustento nos próximos meses; todavia esta tosa tem que ser feita com responsabilidade para que não venha prejudicar as ovelhas. Muitos criadores de ovelhas fazem isto pessoalmente, mas outros, por não terem experiência no assunto ou não terem tempo para o fazerem, acabam contratando tosquiadores profissionais para fazerem o serviço. Todavia a pessoa que irá tosquiar as ovelhas precisa ter no mínimo "consciência", para que possa fazer a tosquia com "responsabilidade", de uma maneira que venha beneficiar o pastor das ovelhas, mas sem prejudica-las. A lã não pode ser retirada toda! É necessário que o tosquiador deixe um pouco de lã para a ovelha, pois as condições climáticas não é ele quem determina; e, se nos próximos dias o tempo mudar e fizer frio, a ovelha tem que ter um pouco de lã para se aquecer e não morrer de frio. 

O problema é que normalmente o tosquiador contratado ganho por quilo de lã tirada; ou seja, o salário é combinado em cima de uma porcentagem do que é tirado e desta maneira quanto mais ele tira, mais ele ganha. Assim, muitos tosquiadores que não entendem nada de tosquia e que são gananciosos demais estão prejudicando o rebanho, pois tiram toda a lã da ovelha, não dando chance para ela se defender de uma possível noite fria. Tais homens só pensam no seu lucro. Em quanto irão levar no final do seu dia. Não estão preocupados com o bem estar das ovelhas, pois estas não são suas mesmo, não estão nem aí para o rebanho e com esta filosofia de trabalho (se é que podemos chamar isso de trabalho), acabam judiando das ovelhas; pois além de tirarem toda a lã parecem que querem tirar até o coro (a pele), e o resultado disto é que no final de uma tosquia muitas ovelhas às vezes saem machucadas. O que estamos vendo hoje em dia nos púlpitos de algumas igrejas é de causar preocupação!Tosquiadores profissionais que não sabem nada de tosquia, tirando toda a lã das ovelhas, fazendo votos assustadores e dizendo que Deus quer o teu "TUDO". Tais homens pedem tudo mesmo, a tua casa que você conquistou com tanto trabalho, o teu carro, todo o teu salário, todas as tuas economias, eles dizem: Quem tem fé para entregar o seu TUDO! 

Contratados por pastores irresponsáveis, estes tosquiadores tiram até a última moeda das pessoas, não se preocupando em deixar pelo menos o dinheiro da condução para elas voltarem para casa; não entendendo que assim como as condições climáticas não é o homem quem determina, assim também as condições de vida de cada pessoa não são determinadas por nós e sim por Deus; e, nós como pastores, devemos fazer a tosa das ovelhas, porque isto é bom para elas e também para nós, mas fazer com temor e tremor diante de Deus preocupando-nos em não tirar o coro delas e não machuca-las e entendendo que amanhã poderá vir uma noite fria (dias difíceis) na vida destas pessoas e que elas precisam ter alguma lã (dinheiro) para se aquecerem. 

Caro amigo PASTOR, não entregue o seu rebanho nas mãos destes tosquiadores que se acham profissionais, mas que não sabem nada de tosquia.

sábado, 10 de novembro de 2018

O Cristão e o Historiador


Como historiador, cabe-me o papel de Tomé; preciso ver para crer, pois, a Bíblia não se baseia num pressuposto de fé, mas na confrontação de dados empíricos e ideológicos selecionados, cruzados, seriados, todos fornecidos pela documentação, com as informações colocadas pela bibliografia concernente ao objeto de estudo, sempre no intuito de se fazer a relação do texto para com o contexto no qual ele foi produzido. Uma fonte historiográfica riquíssima, e não podendo ser desprezada pela erudição moderna, corre-se o risco de atitude preconceituosa e leviana, tendo em vista o seu valor na elaboração do mundo ocidental contemporâneo. Seus textos têm sido lidos como documentos históricos iguais a quaisquer outros - no caso, que preservam informações antigas e importantes ao mesmo tempo em que possuem uma redação tardia e tendenciosa. A leitura da Bíblia envolve a mobilização de instrumentos de crítica que ajudem a ler o documento de forma objetiva – procedimento igualmente aplicado a qualquer tipo de estudo histórico. Aceito-as como fonte histórica confiável. Encaro a no ponto de vista historiográfico. Tenho bem claro minha condição de cientista e mantenho neutralidade e equidade em relação aos fatos que analiso, não deixando minhas convicções religiosas ou de outrem, interferir em minhas análises sobre os eventos pesquisados. Sendo indiferente, neutro, ao julgar os fatos históricos, não é querer ser um novo Pilatos; entre Deus e o diabo, entre a Igreja e a anti-Igreja, é preciso tomar partido por Deus e pela Igreja, pela verdade.
A fé independe de evidências. Aliás até pelo contrário; não preciso de "fé" para acreditar na existência da lua, na gravidade ou no fato de que precisamos respirar, pois isso é evidente. Minha fé é justamente uma certeza sem evidências. Creio naquilo que as Escrituras Sagradas dizem. Não preciso me esforçar para crer na doutrina cristã. Apenas creio! Simples assim, como a água.

A Bíblia sagrada dos cristãos não advoga para si a definição de “Documento Histórico”, este conceito não era peculiar aos seus autores. Não se encontra em seus escritos apenas uma tentativa de fidelidade histórica, ainda que isto lhe seja inerente, mas é possível descobrir que seu interesse é religioso, ou seja, concepções religiosas permeiam a narrativa bíblica. A Bíblia não é em hipótese alguma um “Documento Histórico”, ainda que este conceito traga inquietação e perturbação, muito pelo contrário, não se pode domesticar o “texto sagrado” a um mero conceito, a Bíblia vai além de conceitos e formulações. Não se pode desprezar, porém, que isto se dá em um momento histórico definido, portanto, fé e história se entrelaçam, criando assim um ambiente riquíssimo para o historiador moderno.

O cristianismo tem evidências históricas que ratificam sua veracidade. A fé possui raízes históricas que não podem ser ignoradas. A própria Bíblia apresenta todo um conjunto de conceitos nos quais a fé veterotestamentária e neotestamentária são postas como tendo fundamento histórico. Creio e encontro todo um sistema de argumentação racional sobre a validade de minha crença, além do que posso encontrar, nos anais da história e nas descobertas arqueológicas, comprovações de muitas citações bíblicas sobre o modo de crer, viver, legislar etc. dos povos que viveram no tempo que estes escritores descreveram suas histórias ou comporam suas poesias e hinos.

Minha fé é pautada e nutrida tanto por uma visão teleológica da história como também por um forte senso sobre a realidade da providência divina. Está acima de qualquer ofício. E a moral exige que se defenda a verdade. E a verdade é que, na História, a Igreja é crucificada, como Jesus o foi no Calvário.

Antes de ser historiador, sou cristão. Quando eu morrer não serei julgado por Deus como historiador, mas como batizado. Não farei um exame profissional. Não tenho uma confiança cega, por ausência de evidências, ou mesmo diante delas. E, como historiador, não estou destruindo minha fé em nenhum momento, e abandonando os paradigmas deste ofício em prol da defesa da fé. A ciência não anula a fé. Não existe conflito entre fé e ciência. Infelizmente, a ciência tem a capacidade de abordar apenas o que é material, e tentar utilizar a ciência para negar a fé é fazer mal-uso do método científico além de demonstrar uma ignorância histórica sem precedentes.

quinta-feira, 1 de novembro de 2018

O Filho de Yaveh e o filho de Odin


A encarnação de Jesus Cristo é a mais linda, profunda e significativa história de todos os tempos, afinal, trata-se da saga do Deus que Se fez homem para revelar o caráter da Divindade e para morrer em lugar da humanidade devedora, saldando definitivamente essa dívida chamada pecado - história anunciada séculos antes nas profecias messiânicas das Escrituras Hebraicas. É curioso notar que muitas culturas antigas guardam resquícios dessa história, embora com alguns acréscimos, modificações e (muitas) distorções. Por vários motivos (históricos, arqueológicos, científicos, de fé, etc.), creio que a Bíblia preserva a história verdadeira, com cores vivas, porém, sem os elementos míticos e até absurdos típicos de outras culturas, nas quais há mistura de paganismo, misticismo, crendices e geralmente lendas passadas de pai para filho, segundo a tradição oral.

Uma dessas mitologias, que possivelmente reflita elementos do relato da redenção segundo a Bíblia, é a história do deus do trovão Thor e do reino de Asgard, encontrada na cultura nórdica e popularizada recentemente em filme adaptado dos quadrinhos da Marvel. Thor é filho do “pai de todos”, o deus Odin. O irmão de Thor se chama Loki (na mitologia, Loki é um personagem de origem obscura) e tem inveja do deus do trovão, já que este é que está sendo preparado para ocupar o trono do pai. Loki pode ser considerado um deus dos enganos, pois se vale de artimanhas e ilusionismo para alcançar seus objetivos. Ocorre que Thor é banido por Odin, sendo enviado sem poderes para a Terra, onde aprende a se sacrificar pelos outros, adquirindo a dignidade necessária para voltar a empunhar seu martelo mágico, Mjolnir, e a receber de volta seus poderes de deus.

A despeito das divergências entre as histórias bíblica e nórdica, as semelhanças saltam à vista. Loki passa a odiar o irmão e inicia uma rebelião, traindo Odin. Thor é enviado à Terra sem poderes e volta para Asgard, depois de cumprir sua missão aqui. No fim dos tempos, Odin conduzirá os deuses e os homens contra as forças do caos na batalha do fim do mundo, o Ragnarök. Durante essa batalha, Thor matará e será morto pela cria de Loki, Jörmungandr, uma serpente tão grande que envolve a Terra.

Como Jesus, Thor deixou o reino celestial de seu pai e veio para a Terra na semelhança de um homem. Ele tinha que se vestir de humildade e ser bom para a raça humana. Depois que ele aprendeu a lição, ele salvou a humanidade das forças do mal e foi capaz de retornar de onde veio.

No entanto, há diferenças entre eles: Jesus humildemente consentiu por sua própria vontade vir à Terra morrer pelos pecados da humanidade para que todo aquele que Nele crê seja salvo e se tornou servo dos homens. Mas Thor foi expulso por causa de seu orgulho. Jesus é o Deus Criador de todas as coisas, completo e imutável, que não precisava aprender uma lição. Mas Thor era apenas o deus do trovão e precisava aprender a ser humilde. Enquanto Jesus é uma pessoa real, Thor é apenas uma figura mitológica. Há uma lição importante a aprender com as histórias de Thor e Jesus: O orgulho traz humilhação, mas a humildade traz exaltação. Humilhemo-nos, pois, diante de Deus para que Ele possa nos tratar graciosamente, porque “Deus se opõe aos orgulhosos, mas concede graça aos humildes” (Tiago 4:6).


A história verdadeira da rebelião no Céu entre Lúcifer e o filho de Deus, Jesus, encontra eco em diversas culturas, assim como ocorre também com os relatos da criação e do dilúvio; no entanto, à semelhança do que acontece na brincadeira do telefone sem fio, a transmissão desse relato de geração para geração e de povo para povo acabou promovendo distorções e incorporando acréscimos, processo típico da mitologização de histórias;

O inimigo de Deus tem grande interesse em disseminar mitologias que se assemelhem ao relato bíblico, pois, assim, leva as pessoas a considerar o relato escriturístico (preservado em papel e tinta numa língua sempre conhecida e inalterada) também um mito.

Com a riqueza de detalhes que o filme mostra em relação ao Céu (eles chamam de Reino eterno, onde fica o trono de Odin), a arquitetura do lugar é fabulosa, e tudo parece muito com as descrições bíblicas a respeito do Céu; muito ouro, muitas pedras preciosas. Lá tem uma ponte de cristal transparente e colorido, parece com um diamante. Talvez só alguém que já esteve por lá para descrever tão bem assim em imagens, (Ap 21).

Lúcifer e Jesus moravam no Céu, está em conformidade com a Bíblia (Is. 14.12) (Jó 38.7).
Quando Jesus veio para a terra, se tornou um homem assim como um de nós, deixando Sua glória e resplendor que tinha no Céu. (Fp 2.7). Quando Jesus (Thor) é atingido pelo gigante (pecado) e morre, a pesquisadora científica (Igreja) estava lá presenciando tudo. Logo depois da morte de Jesus o poder é restituído completamente. (Mt 28.18). Jesus (Thor) passa a gostar da Igreja (Pesquisadora). Após ressuscitar, Jesus faz-lhe uma promessa que retornaria, e leva a Igreja para ver a sua ascensão aos céus. (Lc 24.51). Lúcifer (irmão de Thor) se apresenta no filme com todas as características a ele inerentes, ou seja, de mentir, de roubar, de destruir, de matar, de enganar etc. No filme Jesus (Thor) tinha dois grandes poderes que o Deus pai havia lhe dado, a capa vermelha (símbolo de autoridade real) e uma espécie de martelo (o poder da palavra):
 "Porventura a minha palavra não é como o fogo, diz o SENHOR, e como um martelo que esmiuça a pedra?" (Jr 23.29).
O pai de todos (pai de Thor) diz em determinado momento, que para um rei o maior símbolo seria aquele martelo, que tanto constrói como destrói. É verdade, o poder da Palavra de Jesus é muito grande e a Bíblia cita vários exemplos, tanto de criação com o poder da sua Palavra como de destruição com o mesmo poder.

Related Posts Plugin for WordPress, Blogger...